About   Help   FAQ
Tyrem19Ove
Endonuclease-mediated Allele Detail
Summary
Symbol: Tyrem19Ove
Name: tyrosinase; endonuclease-mediated mutation 19, Paul Overbeek
MGI ID: MGI:6416505
Gene: Tyr  Location: Chr7:87073979-87142637 bp, - strand  Genetic Position: Chr7, 49.01 cM
Alliance: Tyrem19Ove page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsCRISPR/Cas9 for targeted gene repair with one sgRNA and overlapping oligonucleotide donors to repair the C57 albino mutation. More specifically, embryo injections were done using two guide RNAs, termedPAM1 and PAM2. These guides target sites in the mouse genome located on eitherside of the C57albino mutation at amino acid 77 of the tyrosinase gene. The target sequence for the PAM1 guide RNA was tcagttccccttcaaagggg (tgg). Thetarget sequence for the PAM2 guide RNA was acacagagggccaggactca (ngg). Thedonor DNA was a mixture of two 81 base, 3- dideoxy-capped, oligonucleotidestermed 174 (5- gca cca tct gga cct cag ttc ccc ttc aaa gga gtt gat gataga gag tcc tgg ccc tct gtg ttt tat aat agg acc tgc) and 175 (5- ggt cct attata aaa cac aga ggg cca gga ctc tct atc atc aac tcc ttt gaa ggg gaa ctg agg tccaga tgg tgc ac). These oligos encode thewild-type tyrosinase amino acid sequence (codon 77 underlined) and also alterthe guide RNA target sites to prevent re-cleavage after gene repair. The sequencing revealed thattandem copies of the 81-nucleotide donor sequence had integrated into thegenome. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tyr Mutation:  383 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory