About   Help   FAQ
Slc13a4em1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc13a4em1(IMPC)Hmgu
Name: solute carrier family 13 (sodium/sulfate symporters), member 4; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
MGI ID: MGI:6414526
Gene: Slc13a4  Location: Chr6:35244888-35285061 bp, - strand  Genetic Position: Chr6, 15.26 cM
Alliance: Slc13a4em1(IMPC)Hmgu page
IMPC: Slc13a4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 Protein and 4 guide sequences CCCTGGTACATCCAGCCCCGTCC, CCCTGTTGGATCCTTCCGTTCTC, GGAGCCGGAGCCGTTAGGAGTGG, TGCCCTCACGAATGCTGTGAGGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc13a4 Mutation:  35 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory