About   Help   FAQ
Rad54l2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Rad54l2em1(IMPC)Tcp
Name: RAD54 like 2 (S. cerevisiae); endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6414504
Gene: Rad54l2  Location: Chr9:106565281-106666393 bp, - strand  Genetic Position: Chr9, 57.98 cM, cytoband F1
Alliance: Rad54l2em1(IMPC)Tcp page
IMPC: Rad54l2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1555 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTTGGTTAGCTAATCTACCT targeting the 5' side and GTTAACGTAAACCAGCTATC targeting the 3' side of a critical region. This resulted in a 520-bp deletion, Chr9:106715931-106716450 (GRCm38). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rad54l2 Mutation:  178 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory