Pkm^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pkm^em1(IMPC)Bay
• Name: pyruvate kinase, muscle; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6414486
• Synonyms: Pkm^-
• Gene: Pkm Location: Chr9:59563859-59586655 bp, + strand Genetic Position: Chr9, 32.03 cM
• Alliance: Pkm^em1(IMPC)Bay page
• IMPC: Pkm gene page

Pkm^em1(IMPC)Bay/Pkm^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller with no formation of the egg cylinder and no primitive streak or hallmarks of gastrulation at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences ACCTTCACAAATTAAGAGAA, GTGAAGGTAATTAAAAGCAA, TAAGGAATCGCTGAGTCTCC, and TTAACAGTCGTACTGCAGGC that targeted exon(s) ENSMUSE00000218467.4. This resulted in deletion(s) of 4 bp (location: Chr9:59573289-59573292; GRCm39), 256 bp (location: Chr9:59573018-59573273; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pkm Mutation: 80 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)