About   Help   FAQ
Pkmem1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Pkmem1(IMPC)Bay
Name: pyruvate kinase, muscle; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6414486
Synonyms: Pkm-
Gene: Pkm  Location: Chr9:59563859-59586655 bp, + strand  Genetic Position: Chr9, 32.03 cM
Alliance: Pkmem1(IMPC)Bay page
IMPC: Pkm gene page
Pkmem1(IMPC)Bay/Pkmem1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller with no formation of the egg cylinder and no primitive streak or hallmarks of gastrulation at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences GTGAAGGTAATTAAAAGCAAAGG, CCAGGAGACTCAGCGATTCCTTA, TTAACAGTCGTACTGCAGGCAGG, CCTTTCTCTTAATTTGTGAAGGT, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pkm Mutation:  79 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory