About   Help   FAQ
Atp6v0bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Atp6v0bem1(IMPC)J
Name: ATPase, H+ transporting, lysosomal V0 subunit B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6402781
Gene: Atp6v0b  Location: Chr4:117741523-117744530 bp, - strand  Genetic Position: Chr4, 53.73 cM
Alliance: Atp6v0bem1(IMPC)J page
IMPC: Atp6v0b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTTGGGTCTAGTGCACAG and GAGTAAACTGGGAGTCCGGT, which resulted in a 3425 bp deletion beginning at Chromosome 4 position 117,884,089 bp and ending after 117,887,513 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000761417-ENSMUSE00000737163 (exons 1-8) and 2425 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Atp6v0b Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory