Mipem2(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mipem2(IMPC)H |
| Name: |
major intrinsic protein of lens fiber; endonuclease-mediated mutation 2, Harwell |
| MGI ID: |
MGI:6399919 |
| Gene: |
Mip Location: Chr10:128061707-128067681 bp, + strand Genetic Position: Chr10, 76.49 cM, cytoband D1
|
| Alliance: |
Mipem2(IMPC)H page
|
| IMPC: |
Mip gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences TCTTTGCTACATACGACGAGAGG, TGGAGCCCATGTCAACCCTGCGG, CCCATGTCAACCCTGCGGTCACT, TTGCTACATACGACGAGAGGCGG, which resulted in a Indel.
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Mip Mutation: |
30 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
1 reference(s) |
|