About   Help   FAQ
Iqsec2em1Alev
Endonuclease-mediated Allele Detail
Summary
Symbol: Iqsec2em1Alev
Name: IQ motif and Sec7 domain 2; endonuclease-mediated mutation 1, Andrew P Levy
MGI ID: MGI:6393275
Synonyms: A350V IQSEC2
Gene: Iqsec2  Location: ChrX:150927193-151008232 bp, + strand  Genetic Position: ChrX, 68.46 cM
Alliance: Iqsec2em1Alev page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Constitutively active, Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsUsing CRISPR/Cas9 technology with an sgRNA (GGCAGCCCTGCGGCTCAGGA) and an ssODN template (CTGAGCT GCGCAGCCGCTCAAAGTTCTTATTCATACGGTACTGTCGAAAGGCTGTCTGGATGGTCCTGGCAACACGGCGGCTCAGGAAGGAGCCCCCATACTTCCTCTCCAGCATTTCCACCTGTCAGAGGAACAAGTTCAGAAAG), alanine codon 350 (GCT) was changed ta a valine codon (GTT) (p.Ala350Val, C>T nucleotide substitution). Additionally, a silent mutation in arginine codon 349 (AGG>CGT) was created to prevent the sgRNA from targeting the modified allele. This mutation mimics one found in some patients suffering from intellectual disability and epilepsy and renders the enzyme constitutively active. (J:280198)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Iqsec2 Mutation:  16 strains or lines available
References
Original:  J:280198 Rogers EJ, et al., An IQSEC2 Mutation Associated With Intellectual Disability and Autism Results in Decreased Surface AMPA Receptors. Front Mol Neurosci. 2019;12:43
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory