About   Help   FAQ
Kcnj8em1Nich
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnj8em1Nich
Name: potassium inwardly-rectifying channel, subfamily J, member 8; endonuclease-mediated mutation 1, Colin G Nichols
MGI ID: MGI:6389009
Synonyms: Kir6.1VM
Gene: Kcnj8  Location: Chr6:142510563-142517340 bp, - strand  Genetic Position: Chr6, 74.31 cM
Alliance: Kcnj8em1Nich page
Mutation
origin
Strain of Origin:  (C57BL/6J x CBA/J)F2
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation details

CRISPR/Cas9 technology using gRNA 5' ACGCCACTTCAGGTCTACCA 3' introduced a G to A change at position 193 and an A to G change at position 195 resulting in a valine to methionine substitution at amino acid 65 (V65M). This corresponds to the human V65M mutation associated with Cantu Syndrome. (J:281903)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 13 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Kcnj8 Mutation:  32 strains or lines available
References
Original:  J:281903 Huang Y, et al., Cardiovascular consequences of KATP overactivity in Cantu syndrome. JCI Insight. 2018 Aug 9;3(15)
All:  6 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/01/2026
MGI 6.24
The Jackson Laboratory