Dbpht2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dbpht2em1(IMPC)J |
| Name: |
DNA binding protein with his-thr domain; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6388622 |
| Gene: |
Dbpht2 Location: Chr12:74344248-74347242 bp, + strand Genetic Position: Chr12, 32.46 cM
|
| Alliance: |
Dbpht2em1(IMPC)J page
|
| IMPC: |
Dbpht2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCCTTAACCATGAGTGG and ATAGATATCAGCATCTAGGA, which resulted in a 5723 bp deletion beginning at Chromosome 12 position 74,296,535 bp and ending after 74,302,257 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001420864 (exon 1) and 382 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to generate a null allele.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|