About   Help   FAQ
Dbpht2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dbpht2em1(IMPC)J
Name: DNA binding protein with his-thr domain; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6388622
Gene: Dbpht2  Location: Chr12:74344248-74347242 bp, + strand  Genetic Position: Chr12, 32.46 cM
Alliance: Dbpht2em1(IMPC)J page
IMPC: Dbpht2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCCTTAACCATGAGTGG and ATAGATATCAGCATCTAGGA, which resulted in a 5723 bp deletion beginning at Chromosome 12 position 74,296,535 bp and ending after 74,302,257 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001420864 (exon 1) and 382 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dbpht2 Mutation:  7 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory