Dbpht2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dbpht2^em1(IMPC)J
• Name: DNA binding protein with his-thr domain; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6388622
• Gene: Dbpht2 Location: Chr12:74344248-74347242 bp, + strand Genetic Position: Chr12, 32.46 cM
• Alliance: Dbpht2^em1(IMPC)J page
• IMPC: Dbpht2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCCTTAACCATGAGTGG and ATAGATATCAGCATCTAGGA, which resulted in a 5723 bp deletion beginning at Chromosome 12 position 74,296,535 bp and ending after 74,302,257 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001420864 (exon 1) and 382 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dbpht2 Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)