About   Help   FAQ
Efcab3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Efcab3em1(IMPC)J
Name: EF-hand calcium binding domain 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6388590
Gene: Efcab3  Location: Chr11:104576533-105008363 bp, + strand  Genetic Position: Chr11, Syntenic
Alliance: Efcab3em1(IMPC)J page
IMPC: Efcab3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGGATGCTAAGCTCTCCA and AAAACATCCAGAAGCTTTGG, which resulted in a 269 bp deletion beginning at Chromosome 11 position 104,693,210 bp and ending after 104,693,478 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000353657 (exon 4) and 154 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 63 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Efcab3 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/12/2026
MGI 6.24
The Jackson Laboratory