Ddx46em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ddx46em1(IMPC)Tcp |
| Name: |
DEAD box helicase 46; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:6388358 |
| Synonyms: |
Ddx46- |
| Gene: |
Ddx46 Location: Chr13:55782841-55829069 bp, + strand Genetic Position: Chr13, 30.06 cM, cytoband B2
|
| Alliance: |
Ddx46em1(IMPC)Tcp page
|
| IMPC: |
Ddx46 gene page |
|
Ddx46em1(IMPC)Tcp/Ddx46em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida but form irregular outgrowths.
Show the 1 phenotype image(s) involving this allele.
|
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR1438 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CAGGTGCTAATGACCAGGTC targeting the 5' side and ATGCTTGAAACGGTTACAGC targeting the 3' side of a critical region. This resulted in a 694-bp del Chr13:55647250-55647943 (GRCm38).
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
4 reference(s) |
|