Trnp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trnp1^em1(IMPC)J
• Name: TMF1-regulated nuclear protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6385667
• Gene: Trnp1 Location: Chr4:133218411-133225861 bp, - strand Genetic Position: Chr4, 66.25 cM
• Alliance: Trnp1^em1(IMPC)J page
• IMPC: Trnp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACGGCGCGGCCAGGGCC and CAGGCGCTGATTCGGCAGCC, which resulted in a 649 bp deletion beginning at Chromosome 4 position 133,497,822 bp and ending after 133,498,470 bp (GRCm38/mm10). This mutation deletes 649 bp from ENSMUSE00000775605 (exon 1) including the start sequence and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trnp1 Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)