Urm1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Urm1^em1(IMPC)J
• Name: ubiquitin related modifier 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6385665
• Synonyms: Urm1^-
• Gene: Urm1 Location: Chr2:29717401-29735008 bp, + strand Genetic Position: Chr2, 20.67 cM, cytoband B
• Alliance: Urm1^em1(IMPC)J page
• IMPC: Urm1 gene page

Urm1^em1(IMPC)J/Urm1^em1(IMPC)J embryos are small and developmentally delayed. Almost all E9.5 embryos display incomplete turning and abnormal head shape and most have abnormal branchial arches. Half of E9.5 embryos have abnormal cranial neural tube closure, abnormal cardiac development and slight neural tube kinking. E10.5 embryos not dying have abnormal head and slight neural tube kinking.

Show the 6 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGCACTGGGCACAGTTTT and ACAATCAGAACCCCAGGACG, which resulted in a 212 bp deletion beginning at Chromosome 2 position 29,841,335 bp and ending after 29,841,546 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001234693 (exon 3) and 130 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 35 and early truncation 7 amino acids later. (J:188991) Inheritance: Not Specified

Strategy for the generation of the Urm1^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	32 assay results
In Structures Affected by this Mutation:	9 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Urm1 Mutation: 168 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)