About   Help   FAQ
Urm1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Urm1em1(IMPC)J
Name: ubiquitin related modifier 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6385665
Synonyms: Urm1-
Gene: Urm1  Location: Chr2:29717401-29735008 bp, + strand  Genetic Position: Chr2, 20.67 cM, cytoband B
Alliance: Urm1em1(IMPC)J page
IMPC: Urm1 gene page
Urm1em1(IMPC)J/Urm1em1(IMPC)J embryos are small and developmentally delayed. Almost all E9.5 embryos display incomplete turning and abnormal head shape and most have abnormal branchial arches. Half of E9.5 embryos have abnormal cranial neural tube closure, abnormal cardiac development and slight neural tube kinking. E10.5 embryos not dying have abnormal head and slight neural tube kinking.

Show the 6 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGCACTGGGCACAGTTTT and ACAATCAGAACCCCAGGACG, which resulted in a 212 bp deletion beginning at Chromosome 2 position 29,841,335 bp and ending after 29,841,546 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001234693 (exon 3) and 130 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 35 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Strategy for the generation of the Urm1em1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 32 assay results
In Structures Affected by this Mutation: 9 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Urm1 Mutation:  168 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory