About   Help   FAQ
Pwwp2bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pwwp2bem1(IMPC)J
Name: PWWP domain containing 2B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6385154
Gene: Pwwp2b  Location: Chr7:138828398-138847172 bp, + strand  Genetic Position: Chr7, 84.39 cM
Alliance: Pwwp2bem1(IMPC)J page
IMPC: Pwwp2b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGATGGAGACAGGCCAAAG and TTCTGGGGCCACGTGTTGTG, which resulted in a 1631 bp deletion beginning at Chromosome 7 position 139,254,777 bp and ending after 139,256,407 bp (GRCm38/mm10). This mutation deletes 1631 bp from ENSMUSE00000911429 (exon 2) and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pwwp2b Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory