About   Help   FAQ
Tle1em1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
Summary
Symbol: Tle1em1(IMPC)Hmgu
Name: transducin-like enhancer of split 1; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
MGI ID: MGI:6384610
Gene: Tle1  Location: Chr4:72036042-72119130 bp, - strand  Genetic Position: Chr4, 36.06 cM, cytoband C3
Alliance: Tle1em1(IMPC)Hmgu page
IMPC: Tle1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 Protein and 4 guide sequences CCTGTCTACCCATAAGCACGTCC, CCCTACCTAGTCCTGTAGCCATG, CCGTTTGAATCGCTGCCAAGCTA, CCGTACAGTGACTAGTGCCTTTC, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tle1 Mutation:  65 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory