Pam^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pam^{em1(IMPC)Hmgu}
• Name: peptidylglycine alpha-amidating monooxygenase; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6384607
• Gene: Pam Location: Chr1:97748816-98023578 bp, - strand Genetic Position: Chr1, 47.76 cM
• Alliance: Pam^{em1(IMPC)Hmgu} page
• IMPC: Pam gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences GTTTGTTCCAGTTACCAACTTGG, TGTTTTGATGGAAAAATGTCAGG, GTTTTGATGGAAAAATGTCAGGG, TTTGCTTAGTGATGGCGTGATGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pam Mutation: 60 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)