About   Help   FAQ
Scfd1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Scfd1em1(IMPC)Tcp
Name: Sec1 family domain containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6383384
Synonyms: Scfd1-
Gene: Scfd1  Location: Chr12:51424296-51496887 bp, + strand  Genetic Position: Chr12, 22.11 cM, cytoband C1
Alliance: Scfd1em1(IMPC)Tcp page
IMPC: Scfd1 gene page
Scfd1em1(IMPC)Tcp/Scfd1em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. In vitro, some blastocysts fail to hatch from the zona pellucida and do not form outgrowths while others do hatch but form outgrowths with no inner cell mass and dispersed trophectoderm.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1478 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCTTAGTGACTGATCGCAGT targeting the 5' side and CAAAACAACTACGGAGTTAG targeting the 3' side of a critical region. This resulted in a 1621-bp deletion Chr12:51388915-51390535 (GRCm38). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Scfd1 Mutation:  33 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory