About   Help   FAQ
Kpna6em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Kpna6em1(IMPC)Wtsi
Name: karyopherin subunit alpha 6; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6382780
Gene: Kpna6  Location: Chr4:129537773-129566560 bp, - strand  Genetic Position: Chr4, 63.28 cM, cytoband D2.3
Alliance: Kpna6em1(IMPC)Wtsi page
IMPC: Kpna6 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated
Mutation:    Single point mutation
 
Mutation detailsThis allele from IMPC was generated at Welcome Sanger Institute by injecting CAS9 RNA, the guide sequence TCCTGCTTCAATGACAATTTTGG, and a donor oligo, which resulted in a Point Mutation allele. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kpna6 Mutation:  44 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory