Plppr5em1(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Plppr5em1(IMPC)H |
| Name: |
phospholipid phosphatase related 5; endonuclease-mediated mutation 1, Harwell |
| MGI ID: |
MGI:6382410 |
| Gene: |
Plppr5 Location: Chr3:117368274-117483157 bp, + strand Genetic Position: Chr3, 51.21 cM, cytoband G2
|
| Alliance: |
Plppr5em1(IMPC)H page
|
| IMPC: |
Plppr5 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences CACCATTACAACAATTGCTG, GAGGTGTTACCCACGTGAAT, GCATCCTAAGCCCATTCACG, and GTGTAATTTAGAGAACTGCC that targeted exon(s) ENSMUSE00000322458.2. This resulted in deletion(s) of 1060 bp (location: Chr3:117418838-117419897; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|