Tmem144^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem144^em1(IMPC)J
• Name: transmembrane protein 144; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6379324
• Gene: Tmem144 Location: Chr3:79719871-79760080 bp, - strand Genetic Position: Chr3, 35.07 cM, cytoband F1
• Alliance: Tmem144^em1(IMPC)J page
• IMPC: Tmem144 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGTATCTGGGAGACAAGT and CCATTGCCTTACGCTCTTGA, which resulted in a 501 bp deletion beginning at Chromosome 3 position 79,833,679 bp and ending after 79,834,179 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000174648 (exon 4) and 401 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 78 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem144 Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)