About   Help   FAQ
Yif1aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Yif1aem1(IMPC)J
Name: Yip1 interacting factor homolog A (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6379294
Gene: Yif1a  Location: Chr19:5138566-5142907 bp, + strand  Genetic Position: Chr19, 4.24 cM, cytoband A
Alliance: Yif1aem1(IMPC)J page
IMPC: Yif1a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAGTCGAGAGGCGCACCG and TTAAAGTCACTGGCTCCAAG, which resulted in a 646 bp deletion beginning at Chromosome 19 position 5,091,215 bp and ending after 5,091,860 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145739 and ENSMUSE00000145750 (exons 5 and 6) and 432 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 142 and early truncation 1 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Yif1a Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory