1700020N01Rik^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: 1700020N01Rik^em1(IMPC)J
• Name: RIKEN cDNA 1700020N01 gene; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6376209
• Gene: 1700020N01Rik Location: Chr10:21469044-21498274 bp, + strand Genetic Position: Chr10, 9.79 cM
• Alliance: 1700020N01Rik^em1(IMPC)J page
• IMPC: 1700020N01Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTTACAACACACTGCGGCA and GTAATCTAAGCTCGCTCCCG, which resulted in a 732 bp deletion beginning at Chromosome 10 position 21,593,062 bp and ending after 21,593,793 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365479 and ENSMUSE00000335433 (exons 1 and 2) and 401 bp of flanking intronic sequence including the start site and splice donor and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any 1700020N01Rik Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)