About   Help   FAQ
Rr173em1Kmm
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr173em1Kmm
Name: regulatory region 173; endonuclease-mediated mutation 1, Kenneth Murphy
MGI ID: MGI:6368522
Synonyms: Irf8 +41-, Irf8em2Kmm
Gene: Rr173  Location: Chr8:121503787-121504483 bp  Genetic Position: Chr8, Syntenic
Alliance: Rr173em1Kmm page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsPlasmids encoding sgRNA (ggcccttgtagtttagctta and aaagaagatctggggtatgt), designed to delete one of two enhancers located in the super-enhancer of the gene +41 kb downstream from the transcriptional start site. The 361 bp deletion eliminates all six predicted E-box motifs in the +41-kb Irf8 enhancer. (J:279982)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr173 Mutation:  0 strains or lines available
References
Original:  J:279982 Durai V, et al., Cryptic activation of an Irf8 enhancer governs cDC1 fate specification. Nat Immunol. 2019 Sep;20(9):1161-1173
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory