Aatf^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aatf^em1(IMPC)J
• Name: apoptosis antagonizing transcription factor; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6361005
• Synonyms: Aatf^-
• Gene: Aatf Location: Chr11:84313681-84404348 bp, - strand Genetic Position: Chr11, 51.3 cM, cytoband B5
• Alliance: Aatf^em1(IMPC)J page
• IMPC: Aatf gene page

Aatf^em1(IMPC)J/Aatf^em1(IMPC)J mice exhibit embryonic lethality by E3.5. Morula-like embryos fail to hatch from the zona pellucida in vitro.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ATAAGCAAGATAGCAGCACG and GAGTCGCTTTTATATTTAAC that targeted exon(s) ENSMUSE00001250419.2. This resulted in deletion(s) of 427 bp (location: Chr11:84363749-84364175; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Aatf Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)