About   Help   FAQ
Gk2em#Juhu
Endonuclease-mediated Allele Detail
Summary
Symbol: Gk2em#Juhu
Name: glycerol kinase 2; endonuclease-mediated mutation, Junjiu Huang
MGI ID: MGI:6359789
Synonyms: Gk2-, Gk2 KO
Gene: Gk2  Location: Chr5:97603001-97604880 bp, - strand  Genetic Position: Chr5, 47.71 cM
Alliance: Gk2em#Juhu page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele represents a pool of two possible out-of frame deletion null alleles created using an sgRNA (TTGGAAGGCGTGCCAATATC) and CRISPR/Cas9 technology: a two-base deletion of reverse strand AT (c.759_760del) (Gk2em1Juhu) and/or a 14-base deletion of reverse strand CCAATATCTGGATG (c.754_767del) (Gk2em2Juhu). This allele is used where the specific allele or allele combination is not specified. (J:278636)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gk2 Mutation:  19 strains or lines available
References
Original:  J:278636 Chen Y, et al., Glycerol kinase-like proteins cooperate with Pld6 in regulating sperm mitochondrial sheath formation and male fertility. Cell Discov. 2017;3:17030
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory