About   Help   FAQ
Gk2em1Juhu
Endonuclease-mediated Allele Detail
Summary
Symbol: Gk2em1Juhu
Name: glycerol kinase 2; endonuclease-mediated mutation 1, Junjiu Huang
MGI ID: MGI:6359763
Synonyms: Gk2-, Gk2 KO
Gene: Gk2  Location: Chr5:97603001-97604880 bp, - strand  Genetic Position: Chr5, 47.71 cM
Alliance: Gk2em1Juhu page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsA two-base deletion of AT (reverse strand) was created using an sgRNA (TTGGAAGGCGTGCCAATATC) and CRISPR/Cas9 technology, creating a null allele. (J:278636)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gk2 Mutation:  19 strains or lines available
References
Original:  J:278636 Chen Y, et al., Glycerol kinase-like proteins cooperate with Pld6 in regulating sperm mitochondrial sheath formation and male fertility. Cell Discov. 2017;3:17030
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory