Mrgpra1^em1Xzd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrgpra1^em1Xzd
• Name: MAS-related GPR, member A1; endonuclease-mediated mutation 1, Xinzhong Dong
• MGI ID: MGI:6342597
• Synonyms: Mrgpra1^-
• Gene: Mrgpra1 Location: Chr7:46984623-47003988 bp, - strand Genetic Position: Chr7, 30.8 cM
• Alliance: Mrgpra1^em1Xzd page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-Cas9 technology using the guide RNA sequence TTCCCAGCAGCACCTGTGCAGGG generated a 2 bp deletion (CA) at position 75-76 that creates a frameshift resulting in early termination. (J:277452)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mrgpra1 Mutation: 24 strains or lines available

References

• Original: J:277452 Meixiong J, et al., Identification of a bilirubin receptor that may mediate a component of cholestatic itch. Elife. 2019 Jan 21;8:e44116
• All: 3 reference(s)