About   Help   FAQ
Dennd2bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dennd2bem1(IMPC)J
Name: DENN domain containing 2B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6324043
Gene: Dennd2b  Location: Chr7:109123118-109302812 bp, - strand  Genetic Position: Chr7, 57.27 cM, cytoband F2
Alliance: Dennd2bem1(IMPC)J page
IMPC: Dennd2b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCACCGGAAGTCACAGAAC and GGGTAGATGGGACTTCTTGG, which resulted in a 1217 bp deletion beginning at Chromosome 7 position 109,556,205 bp and ending after 109,557,421 bp (GRCm38/mm10). This mutation deletes 1211 bp of ENSMUSE00000384284 (exon 3) after the first 40 bp and 6 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 36 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dennd2b Mutation:  157 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory