About   Help   FAQ
Slc7a3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc7a3em1(IMPC)J
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6316637
Gene: Slc7a3  Location: ChrX:100122816-100129626 bp, - strand  Genetic Position: ChrX, 43.72 cM
Alliance: Slc7a3em1(IMPC)J page
IMPC: Slc7a3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACTCTGGGCCTTCACCAC and TGGCAGGCACTTCGAAGATT, which resulted in a 441 bp deletion beginning at Chromosome X position 101,083,784 bp and ending after 101,084,224 bp (GRCm38/mm10). This mutation deletes 354 bp of ENSMUSE00001284891 (exon 3) after the first 54 bp as well as 87 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc7a3 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory