About   Help   FAQ
Exosc1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Exosc1em1(IMPC)J
Name: exosome component 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6316601
Synonyms: Exosc1-
Gene: Exosc1  Location: Chr19:41911417-41921836 bp, - strand  Genetic Position: Chr19, 35.46 cM, cytoband D1
Alliance: Exosc1em1(IMPC)J page
IMPC: Exosc1 gene page
Exosc1em1(IMPC)J/Exosc1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos at E5.5 appear as normal egg cylinder although with slightly disorganized ectoderm and at E7.5 are smaller and do not initiate gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTATGGATGTCACATACCA and GGACTTTAGCTCAGATTGAA, which resulted in a 3625 bp deletion beginning at Chromosome 19 position 41,924,589 bp and ending after 41,928,213 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000278630, ENSMUSE00000278546 (exons 4-7) and 3366 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 64 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 11 assay results
In Structures Affected by this Mutation: 8 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Exosc1 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory