Avl9em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Avl9em1(IMPC)J |
| Name: |
AVL9 cell migration associated; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6307018 |
| Gene: |
Avl9 Location: Chr6:56691884-56738897 bp, + strand Genetic Position: Chr6, 27.72 cM, cytoband C1
|
| Alliance: |
Avl9em1(IMPC)J page
|
| IMPC: |
Avl9 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGACCCTTTAAATCAGCT and TCTGGGCAGGAGGGAGCCGA, which resulted in a 786 bp deletion beginning at Chromosome 6 position 56,723,008 bp and ending after 56,723,793 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208835 (exon 2) and 665 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 31 amino acids later. There is a single bp (T) insertion at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|