About   Help   FAQ
Avl9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Avl9em1(IMPC)J
Name: AVL9 cell migration associated; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6307018
Gene: Avl9  Location: Chr6:56691884-56738897 bp, + strand  Genetic Position: Chr6, 27.72 cM, cytoband C1
Alliance: Avl9em1(IMPC)J page
IMPC: Avl9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGACCCTTTAAATCAGCT and TCTGGGCAGGAGGGAGCCGA, which resulted in a 786 bp deletion beginning at Chromosome 6 position 56,723,008 bp and ending after 56,723,793 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208835 (exon 2) and 665 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 31 amino acids later. There is a single bp (T) insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Avl9 Mutation:  52 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory