About   Help   FAQ
St13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: St13em1(IMPC)J
Name: suppression of tumorigenicity 13; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6306895
Gene: St13  Location: Chr15:81247870-81284278 bp, - strand  Genetic Position: Chr15, 38.07 cM, cytoband E2
Alliance: St13em1(IMPC)J page
IMPC: St13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAAAAGTGAAGTTCCCCG and AGTAGTAGTTATTTCTAGCA, which resulted in a 426 bp deletion beginning at Chromosome 15 position 81,388,213 bp and ending after 81,388,638 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000126258 (exon 4) and 355 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any St13 Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory