About   Help   FAQ
Zfp638em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp638em1(IMPC)J
Name: zinc finger protein 638; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6304325
Gene: Zfp638  Location: Chr6:83844050-83963855 bp, + strand  Genetic Position: Chr6, 36.06 cM
Alliance: Zfp638em1(IMPC)J page
IMPC: Zfp638 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCAAGCTGACAAATCAATT and ATTATCACGCTTGTAAAGAA, which resulted in a 136 bp deletion beginning at Chromosome 6 position 83,934,897 bp and ending after 83,935,032 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000194351 (exon 3) and 74 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 437 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp638 Mutation:  78 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory