About   Help   FAQ
Slc38a6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc38a6em1(IMPC)J
Name: solute carrier family 38, member 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6283587
Gene: Slc38a6  Location: Chr12:73333553-73400823 bp, + strand  Genetic Position: Chr12, 30.42 cM
Alliance: Slc38a6em1(IMPC)J page
IMPC: Slc38a6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATTTGACTTAAGTACAAGT and TTGACTCTCACACATCAGAG, which resulted in a 377 bp deletion beginning at Chromosome 12 position 73,291,923 bp and ending after 73,292,299 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365160 (exon 3) and 303 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 39 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc38a6 Mutation:  37 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory