About   Help   FAQ
Dipk1cem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dipk1cem1(IMPC)J
Name: divergent protein kinase domain 1C; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6283585
Gene: Dipk1c  Location: Chr18:84737361-84758561 bp, + strand  Genetic Position: Chr18, 57.53 cM
Alliance: Dipk1cem1(IMPC)J page
IMPC: Dipk1c gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAACAGAGGGTCACTGCA and GAGACATCTCACTTCCTTGA, which resulted in a 965 bp deletion beginning at Chromosome 18 position 84,730,001 bp and ending after 84,730,965 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000374665 (exon 3) and 305 bp of flanking intronic sequence including the splice acceptor and translation start and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dipk1c Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory