About   Help   FAQ
Lurap1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lurap1em1(IMPC)J
Name: leucine rich adaptor protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6281355
Gene: Lurap1  Location: Chr4:115993925-116001813 bp, - strand  Genetic Position: Chr4, 53.1 cM, cytoband C7
Alliance: Lurap1em1(IMPC)J page
IMPC: Lurap1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTCATTATTTGTCTCCCAA and ACCTCGCTCCCCCAACTGCG, which resulted in a 566 bp deletion beginning at Chromosome 4 position 116,144,128 bp and ending after 116,144,693 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000337750 (exon 1) and 253 bp of flanking intronic sequence including the translation start and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lurap1 Mutation:  10 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory