About   Help   FAQ
Crtac1em1(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Crtac1em1(IMPC)H
Name: cartilage acidic protein 1; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6276953
Synonyms: Crtac1-
Gene: Crtac1  Location: Chr19:42271474-42421405 bp, - strand  Genetic Position: Chr19, 36.07 cM
Alliance: Crtac1em1(IMPC)H page
IMPC: Crtac1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences TAGACCTAGATTCCGGACTCTGG, CCCCTGTTGCACCTTCAATATTA, CCATTAGACCTAGATTCCGGACT, CCTGTTGCACCTTCAATATTATA, which resulted in a Exon Deletion. (J:265051, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 3 strains available      Cell Lines: 0 lines available
Carrying any Crtac1 Mutation:  45 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory