Nap1l5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nap1l5^em1(IMPC)J
• Name: nucleosome assembly protein 1-like 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6273660
• Gene: Nap1l5 Location: Chr6:58882218-58884061 bp, - strand Genetic Position: Chr6, 27.9 cM, cytoband C1
• Alliance: Nap1l5^em1(IMPC)J page
• IMPC: Nap1l5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGTTATCAGAAAAGAATA and CGAGCCGCGAAGCGGCCGCG, which resulted in a 2165 bp deletion beginning at Chromosome 6 position 58,904,976 bp and ending after 58,907,140 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000459071 (exon 1) and 321 bp of flanking intronic sequence including the Kozak sequence and start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nap1l5 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)