About   Help   FAQ
Ssu72em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ssu72em1(IMPC)J
Name: Ssu72 RNA polymerase II CTD phosphatase homolog (yeast); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6267327
Gene: Ssu72  Location: Chr4:155789272-155818336 bp, + strand  Genetic Position: Chr4, 87.07 cM, cytoband E2
Alliance: Ssu72em1(IMPC)J page
IMPC: Ssu72 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCTAACATGGGAAGCACA and ATACAGGTCAGAGGATGTGG, which resulted in a 439 bp deletion beginning at Chromosome 4 position 155,731,135 bp and ending after 155,731,573 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000184815 (exon 3) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 23 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ssu72 Mutation:  71 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory