About   Help   FAQ
Thoc7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Thoc7em1(IMPC)J
Name: THO complex 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6260024
Synonyms: Thoc7-
Gene: Thoc7  Location: Chr14:8507911-8520751 bp, + strand  Genetic Position: Chr14, 7.08 cM, cytoband A2
Alliance: Thoc7em1(IMPC)J page
IMPC: Thoc7 gene page
Thoc7em1(IMPC)J/Thoc7em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida and form irregular outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCCTTAATAAAGTTCCACC and GGTATATCTGCCTGTCCTAG, which resulted in a 569 bp deletion beginning at Chromosome 14 position 13,954,335 bp and ending after 13,954,903 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000517611 (exon 2) and 451 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Thoc7 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory