Ubtd1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ubtd1em1(IMPC)J |
| Name: |
ubiquitin domain containing 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6259635 |
| Gene: |
Ubtd1 Location: Chr19:41970202-42023082 bp, + strand Genetic Position: Chr19, 35.56 cM
|
| Alliance: |
Ubtd1em1(IMPC)J page
|
| IMPC: |
Ubtd1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGAAGTCCCTGATAGGCCA and ATGAGACTAGGGCCCCCAGG, which resulted in a 2945 bp deletion beginning at Chromosome 19 position 42,031,812 bp and ending after 42,034,756 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000148508 and ENSMUSE00000384994 (exons 2 and 3) and 1664 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 25 and early truncation 61 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|