About   Help   FAQ
Dhx37em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dhx37em1(IMPC)J
Name: DEAH-box helicase 37; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6258465
Synonyms: Dhx37-
Gene: Dhx37  Location: Chr5:125490922-125511185 bp, - strand  Genetic Position: Chr5, 64.2 cM
Alliance: Dhx37em1(IMPC)J page
IMPC: Dhx37 gene page
Dhx37em1(IMPC)J/Dhx37em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae. Mutants fail to hatch from the zona pellucida and never reach blastocyst stage in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AAAACTGCCGTGGATCTCAA, AGACGAACAGAGTCTCACTA, GCACCAGCTCTCCAGATCAG and ATATTTGTCATGAGTAAGCA, which resulted in a 232 bp deletion beginning at Chromosome 5 position 125,431,557 bp and ending after 125,431,788 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001016994 (exon 2) and 62 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dhx37 Mutation:  39 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory