Dhx37^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhx37^em1(IMPC)J
• Name: DEAH-box helicase 37; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258465
• Synonyms: Dhx37^-
• Gene: Dhx37 Location: Chr5:125490922-125511185 bp, - strand Genetic Position: Chr5, 64.2 cM
• Alliance: Dhx37^em1(IMPC)J page
• IMPC: Dhx37 gene page

Dhx37^em1(IMPC)J/Dhx37^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae. Mutants fail to hatch from the zona pellucida and never reach blastocyst stage in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AAAACTGCCGTGGATCTCAA, AGACGAACAGAGTCTCACTA, ATATTTGTCATGAGTAAGCA, and GCACCAGCTCTCCAGATCAG that targeted exon(s) ENSMUSE00001016994.2. This resulted in deletion(s) of 232 bp (location: Chr5:125508621-125508852; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dhx37 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)