Usb1^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Usb1^em1(IMPC)Bay
• Name: U6 snRNA biogenesis 1; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6257807
• Synonyms: Usb1^-
• Gene: Usb1 Location: Chr8:96058912-96074135 bp, + strand Genetic Position: Chr8, 47.12 cM
• Alliance: Usb1^em1(IMPC)Bay page
• IMPC: Usb1 gene page

A minority of Usb1^em1(IMPC)Bay/Usb1^em1(IMPC)Bay (-/-) embryos are developmentally delayed and have abnormal tail shape at E9.5. Almost all E10.5 embryos are delayed, have abnormal blood deposition, abnormally shaped branchial arches and head, and some have abnormal tails and incomplete turning.

Show the 3 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AATAAAAAGCCCGGAGAGCA, ACTATGGAGGAGCTCATGTA, ACTCCTGGAAGCAGGCTGTA, and GACAGACTCAACACAGACTA that targeted exon(s) ENSMUSE00001254583.2. This resulted in deletion(s) of 440 bp (location: Chr8:96065160-96065599; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	49 assay results
In Structures Affected by this Mutation:	4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Usb1 Mutation: 23 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 6 reference(s)