About   Help   FAQ
Tm4sf20em1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Tm4sf20em1(IMPC)Bay
Name: transmembrane 4 L six family member 20; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6257612
Gene: Tm4sf20  Location: Chr1:82734370-82746182 bp, - strand  Genetic Position: Chr1, 42.48 cM, cytoband C5
Alliance: Tm4sf20em1(IMPC)Bay page
IMPC: Tm4sf20 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences CCCAACGGGCAATAAATGGA and CTACTGGGACAAACATTCGT that targeted exon(s) ENSMUSE00000156289.2 ENSMUSE00001222463.2. This resulted in deletion(s) of 3996 bp (location: Chr1:82737793-82741788; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tm4sf20 Mutation:  11 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory