Ankrd48em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
Symbol: |
Ankrd48em1(IMPC)Tcp |
Name: |
ankyrin repeat domain 48; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
MGI ID: |
MGI:6257592 |
Gene: |
Ankrd48 Location: Chr11:5519684-5639337 bp, + strand Genetic Position: Chr11, 3.71 cM, cytoband A1
|
Alliance: |
Ankrd48em1(IMPC)Tcp page
|
IMPC: |
Ankrd48 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project TCPR1201 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACTGCGGTCGTCCTGAACTA and TTGCAATGCCCTCTCCTTCG targeting the 5' side and AATGGTCCCACATATTGTTC and TCGCTTTCAGCTTCTACGTG targeting the 3' side of a critical exon resulting in a 673-bp deletion Chr11: 5570832 to 5571504 (GRCm38).
(J:265051)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
All: |
2 reference(s) |
|