About   Help   FAQ
Fam53cem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fam53cem1(IMPC)J
Name: family with sequence similarity 53, member C; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6241421
Gene: Fam53c  Location: Chr18:34891959-34906813 bp, + strand  Genetic Position: Chr18, 18.72 cM
Alliance: Fam53cem1(IMPC)J page
IMPC: Fam53c gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGCATTTTTGAGGAGGAG and GTTAAAATTCAATACTGCCA, which resulted in a 1151 bp deletion beginning at Chromosome 18 position 34,767,928 bp and ending after 34,769,078 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000483922 (exon 4) and 366 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 46 and early truncation 27 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fam53c Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory