About   Help   FAQ
Cd4em1Litt
Endonuclease-mediated Allele Detail
Summary
Symbol: Cd4em1Litt
Name: CD4 antigen; endonuclease-mediated mutation 1, Dan R Littman
MGI ID: MGI:6220669
Synonyms: Cd4E4mdelta, Rr95em1Litt
Gene: Cd4  Location: Chr6:124841655-124865184 bp, - strand  Genetic Position: Chr6, 59.17 cM
Alliance: Cd4em1Litt page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 technology was used with gRNAs (targeting AAGCCAGGCTACTTGTTTAC and ACTGACACACCCGCTCATCA), resulting in a deletion of the "maturity" enhancer E4m, a cis regulatory element in intron 1 of the Cd4 gene (chr6:124861963-124862659 (GRCm39)). (J:266228)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cd4 Mutation:  85 strains or lines available
References
Original:  J:266228 Issuree PD, et al., Stage-specific epigenetic regulation of CD4 expression by coordinated enhancer elements during T cell development. Nat Commun. 2018 Sep 5;9(1):3594
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory