Arglu1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arglu1^em1(IMPC)J
• Name: arginine and glutamate rich 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6208886
• Gene: Arglu1 Location: Chr8:8715075-8740521 bp, - strand Genetic Position: Chr8, 3.57 cM
• Alliance: Arglu1^em1(IMPC)J page
• IMPC: Arglu1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGTTTGAAACTTTTGCCA and AAGTTAGTTTTCTAATTCTT, which resulted in a 544 bp deletion beginning at Chromosome 8 position 8,683,487 bp and ending after 8,684,030 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000638285 (exon 2) and 318 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 113 and early truncation 14 amino acids later. In addition, there is a 5 bp insertion (ACCTG) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arglu1 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)