About   Help   FAQ
Pfdn1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pfdn1em1(IMPC)J
Name: prefoldin 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6195846
Gene: Pfdn1  Location: Chr18:36536732-36587548 bp, - strand  Genetic Position: Chr18, 19.46 cM
Alliance: Pfdn1em1(IMPC)J page
IMPC: Pfdn1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCACGGGGCTCTCTTAGGAG, GTAGCCAGAGAGTAATAAAA, TCTCACTCTCTGTCGGGGCA and GGTCATGCGGTCTATGGATA, which resulted in a 493 bp deletion beginning at Chromosome 18 position 36,451,035 bp and ending after 36,451,527 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000141136 (exon 2) and 326 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 24 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pfdn1 Mutation:  171 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory