1600014C10Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
1600014C10Rikem1(IMPC)J |
| Name: |
RIKEN cDNA 1600014C10 gene; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6194257 |
| Gene: |
1600014C10Rik Location: Chr7:37882642-37896992 bp, + strand Genetic Position: Chr7, 25.36 cM, cytoband B1
|
| Alliance: |
1600014C10Rikem1(IMPC)J page
|
| IMPC: |
1600014C10Rik gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGCCTCATTCCCCAACAA, GCACTGCCTACACAGGACTG, TCTTAGTTGGCACAGTTCTG and GACCGGGGCTCTCTGTGTGG, which resulted in a 3,339 bp deletion beginning at Chromosome 7 position 38,194,467 bp and ending after 38,197,805 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000635238 and ENSMUSE00000446563 (exons 3,4) and 480 bp of flanking intronic and 3 downstream sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 43 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|